Fish | D.N.A ceo
@fishgamign.bsky.social
vocaloid nerd of 4 years | homestuck nerd of about 10 months | 20 | mc, touhou, homestuck, and too many others | he/they | mikoomf + kanaoomf + ceo of D.N.A | kanade yume | formerly the #1 kanade fan
If Yunyun has a milion fans, I am one of them. If Yunyun has ten fans, I am one of them. If Yunyun has only one fan, that is me. If Yunyun has no fans, I no longer exist on this earth. If the whole world is against Yunyun, I am against the whole world.
btw if you still consume and promote new harry potter media you are a bad person point blank. and the more you try to defend yourself the more trans kids will die and be stripped off their humanity bc you keep funding that shit so go fuck yourself there really is no excuse any more
what videogame would you erase all memories of from yourself just to experience it for the first time again i'll start Splatoon 2 Octo Expansion
saw a tiktoker conspiracyposting, and then they immediately slid into a crypto ad
it really sucks how you alone are the one solely responsible for preventing forest fires
The comic con worker watching me shout “Ja-orange” as I hurl a mouse at the nearest child
when i type gaster as my username when creating a new bluesky account and bluesky turns into some random 90s web forum
end all aibros immediately we have moved on from idiots blatantly violating gpl to idiots asking ai to do things and ai blatantly violating gpl to do them
Liberals frustrate me to no end because you can tell they really think that America is a good idea at the core and thats just not true. You see the shade of it in this hope that Trump dies today and the whole world celebrates the 4th of July going forward
me when i get stuck in a doomed timeline in SBURB so i rename a consort GASTER so i get sent back to before the session started
if you're playing chapter 5 play the weird route first trust me on everything
when the opps got sentient ai so you lowkey gotta ⬆️⬇️⬆️➡️➡️⬅️🅰️⚪⚫ act now ⚪
you'll be on a walk and find the most beautiful flowers and google wil ltell you "yeah this is bitchum assidae and its a highly invasive flower that kills firstborn children and literally created global warming" like fuck i cant have anything good in life who the fuck likes flowers thats gay as hell
aaaaaaaaaaaand the leaks were real fuck my stupid chungus life
I'm going to predict how chapter 5 snowgrave's gonna go (even though i have no clue how its gonna go normally)
"Everyone is my servant they just dont know it yet" oh BROTHER this guy STINKS #vaguepost
SPONGE BOY ME BOB IVE SEQUENCED THE HUMAN GENOME AGCAGCAGCGGCAGCAGATACACGTACGATGC
this 102 year old anime franchise still warps sexual development the old fashioned way
