📢 BIG NEWS in ISEH's journal Experimental Hematology!!! 2 new article types specifically designed for research often difficult to publish: validated protocols, null results, phenotyping & high-value datasets. Plus fast-track review + a $650 incentive! 🔗 iseh.org/Publications...

ISEH - International Society for Experimental Hematology@isehsociety.bsky.social · 6d ago

📢 Experimental Hematology, the official journal of ISEH, has launched new article types and author incentives! View the latest updates and submit your next manuscript: iseh.org/Publications...

On behalf of the Editorial Board of Experimental Hematology, we can’t share enough how excited we are about our new article types—Standards in Hematology and ExpHem Insights. A real chance to highlight best practices and key research—there’s no other venue in the field. Major relaunch!

ISEH - International Society for Experimental Hematology@isehsociety.bsky.social · 6d ago

📢 Experimental Hematology, the official journal of ISEH, has launched new article types and author incentives! View the latest updates and submit your next manuscript: iseh.org/Publications...

#zebrafish New runx1-2A-creERT2 KI line now posted on zebrafishccr.org/runx1-2a-cre... Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!

runx1-2A-creERT2 - Zebrafish Community Cre/lox Resource

KI Name runx1-2A-creERT2 Gene runx1 (ZFIN) ZFIN Gene Page runx1 family transcription factor 1 Lineage blood; HSCs Target Location exon 7 gRNA PAM GACGGCCTCTACAGACATGCTGG Genotype Tg(runx1-2A-creERT2; ...

zebrafishccr.org

#zebrafish Our Zebrafish Community Cre/lox Resource is online!! zebrafishccr.org Check out what's available, imaging and information, and make a request. We're so very grateful to the NIH ORIP for supporting this work! Huge thanks to Parnal Joshi from Iddo Friedberg lab for creating the website!

Zebrafish Community Cre/lox Resource - Zebrafish Community Cre/lox Resource

Bringing you precision Cre/CreERT2 and floxed lines driven by GeneWeld CRISPR targeted integration. Mission Our mission is to provide the Zebrafish community with Cre resources that open new areas of ...

zebrafishccr.org

Amazing new #runx1 knock-in lineage-tracing tool for the #zebrafish #hematopoieitic community from @mcgraillab.bsky.social, led by talented Preston 🐟🧬✂️ Huge thanks for developing another incredible resource and for the opportunity to help 🩸🧫 Excited to see all the discoveries this tool will enable!

Zebrafish Rock!@zebrafishrock.bsky.social · 4w ago

New transgenic on the block! From the unstoppable coalition of @mcgraillab.bsky.social, Jeffrey Essner, @genetrapper.bsky.social, @scekker.bsky.social & newcomer @espinlab.bsky.social 🐟🧬

The latest paper from the Espin lab is out! 🍾🎉 www.cell.com/cell-reports...

Synergistic cooperation between progranulin and Jak2/Stat3 signaling determines definitive myeloid cell fate

McCune et al. demonstrate that progranulin enforces myeloid fate by regulating JAK2/STAT3 and uncover functional differences between two embryonically derived macrophage populations. These findings pr...

cell.com

Happening later today 🚨 There's still time to register for the Skeletal Disease RIG Meet up: us06web.zoom.us/meeting/regi...

Zebrafish Disease Models Society (ZDMS)@zdmsociety.bsky.social · 2mo ago

On the #ZDMS itinerary for this week: Infection & Inflammation RIG Meet Up on Wednesday (3rd) 🦠🐟 and Skeletal Disease RIG Meet Up on Thursday (4th) 🦴🐟 Both webinars start at 7AM PST | 10AM ET | 3PM BST | 4PM CEST | 7:30 IST. More details about these FREE events & how to register below ⬇️

Only a couple of hours left to join us for the free ZDMS Infection&Inflammation RIG seminar! We have a great line up of speakers! Register here! 👇

Zebrafish Disease Models Society (ZDMS)@zdmsociety.bsky.social · 2mo ago

On the #ZDMS itinerary for this week: Infection & Inflammation RIG Meet Up on Wednesday (3rd) 🦠🐟 and Skeletal Disease RIG Meet Up on Thursday (4th) 🦴🐟 Both webinars start at 7AM PST | 10AM ET | 3PM BST | 4PM CEST | 7:30 IST. More details about these FREE events & how to register below ⬇️

On the #ZDMS itinerary for this week: Infection & Inflammation RIG Meet Up on Wednesday (3rd) 🦠🐟 and Skeletal Disease RIG Meet Up on Thursday (4th) 🦴🐟 Both webinars start at 7AM PST | 10AM ET | 3PM BST | 4PM CEST | 7:30 IST. More details about these FREE events & how to register below ⬇️

Our Stem Cells & Developmental Biology program is live! We've built something rare: an integrated community of basic & translational scientists, innovative technologies & humanized models — all aimed at improving human health. @jax.org 🔗 go.jax.org/stem-cell-research #JAXresearch #JAXstemcellsdev

Stem Cells & Developmental Biology

At JAX, we investigate how genetic and epigenetic programs govern stem cell fate, tissue growth and patterning, and regeneration—and how these processes can be restored in disease—by integrating devel...

go.jax.org

Join us for a FREE webinar as part of our 2026 RIG Meet Ups series ✨ Next up: Hematology with 3 superb experts on Wednesday (20th)🩸🐟 While free for the public, you must register for access ➡️ us06web.zoom.us/meeting/regi.... For a full list of webinars, check out: www.zdmsociety.org/2026-zdms-ri...

🧪📣Join us May 27 at 1 PM ET for Dr. Andres Hidalgo, Yale Immunology, presenting “Understanding Neutrophils.” Free registration for all. Come for great leukocyte biology and discussion. slb.memberclicks.net/building-bri...

Society for Leukocyte Biology@leukocytebiology.bsky.social · 3mo ago

This month’s FREE FOR ALL seminar is on May 27th 1pm-2pm ET. Dr. Andres Hidalgo from Yale University will present on "Understanding Neutrophils". Get more info and register here: www.leukocytebiology.org/index.php?op...

Thinking of going to #ZDM19? Don't let the cost of travel deter you! ZDMS members are eligible for travel awards 💸 You can apply for these when you submit an abstract: www.zdmsociety.org/zdm19-abstra... Members also get discounted registration fees! To sign up: www.zdmsociety.org/membership-s... 🐟

New preprint from my lab! Will Anderson developed a transgenic #zebrafish ubiquitously expressing an optogenetic FGF/ERK activator. We're having a lot of fun with it and think you will too! www.biorxiv.org/content/10.6...

The first webinar (on Cancer Technology) from our 2026 RIG Meet Ups series starts this upcoming Monday (May 4th) at 7AM PST | 10AM ET | 3PM BST | 4PM CEST | 5PM IDT | 7:30 IST. To sign-up for the FREE event, you must register here: us06web.zoom.us/meeting/regi... #ZDMS #zebrafish #RIGMeetups2026 🐟

Thank you to past&present members of the Espinlab, colleagues and chair of #GDCB and #ISU, letter writers, collaborators, and to my husband! I got promoted to Associate Professor this week, and that wouldn’t have happened without the great support from everyone! 🙏😊

Thanks @isehsociety.bsky.social for highlighting our recent paper relating infection history to the emergence of clonal hematopoiesis! Super collab with Elizabeth Platz and the ARIC longitudinal study! @bcmhouston.bsky.social

ISEH - International Society for Experimental Hematology@isehsociety.bsky.social · 4mo ago

What role does immune challenge play in selecting mutant hematopoietic clones? Read insights into infection frequency and CHIP risk: www.exphem.org/article/S030.... @thekinglab.bsky.social

Don't forget to register to attend next week's Mini Symposium! With featured presentations from @beth_psaila, Simón Méndez-Ferrer, PhD, @JianXuLab, and short talks from selected abstracts, you won't want to miss this event. View program & register👉️ iseh.org/Webinars-Eve...

Just delivered a Data Visualization for Publishing talk at #EHAReCon2026! At the same time: ✈️ First trip to Finland 🏢 Learned about Alvar Aalto’s incredible architectural design 🌱 Discovered new mosses 🤝🏻 Got to see friends, and meet new ones 🎨 Sketch time! What a great week!

Register to attend the 2026 Mini Symposium! With featured presentations from Bethan Psaila, MBBS, PhD, Simón Méndez-Ferrer, PhD, Jian Xu, PhD, and selected abstracts, you won't want to miss this event! Register👉️ iseh.org/Webinars-Eve...

Switching fields or wanting to become an expert in #zebrafish research? The @mblscience.bsky.social 2026 Zebrafish Development & Genetics course offers a fantastic opportunity to learn from leaders in the field! Application deadline: March 2 Please spread the word! www.mbl.edu/education/ad...

Submit an abstract for the 2026 Mini Symposium by 28 February! Abstract submitters will have a chance to earn a symposium short talk, travel grant and #ISEH2026 🏙️ speaking slot. 👉️ iseh.org/Webinars-Eve...

Keynote speakers have been confirmed for #ZDM19 in Oxford! Featuring @tristanorth.bsky.social (@bostonchildrens.bsky.social)& KJ Patel (@imm.ox.ac.uk) 🤩 Stay up-to-date on the conference by visiting www.zdmsociety.org/zdm19 & following @zdmsociety.bsky.social (They will eventually post things!) 🧪

Have you ever wondered about Pig HSCs? Today is your lucky day! Check out this excellent work from @ganuzalab.bsky.social. Well done! Pig and human adult hematopoietic stem and progenitor cells are overall transcriptionally similar. www.exphem.org/article/S030... @isehsociety.bsky.social

Pig and human adult hematopoietic stem and progenitor cells are overall transcriptionally similar

Allotransplantation provides a lifesaving treatment to hundreds of thousands of patients worldwide every year, including among others heart, kidney, liver and bone marrow (BM) transplants [1,2]. Yet, ...

exphem.org

📣Building Bridges in Leukocyte Biology #BBinLB webinar series hosted by the @leukocytebiology.bsky.social Next speaker: @oehlerslab.org "Differential subversion of host immune signalling by tuberculous and non-tuberculous mycobacteria" 📅 Jan 28 at 9 am EST -register free link below #Zebrafish

Check out our collaborative Review Article with Dr Momoko Yoshimoto on: HSC-independent and -dependent hematopoiesis: new insights and lineage tracing methods. - Experimental Hematology www.exphem.org/article/S030... @isehsociety.bsky.social @qmbci.bsky.social

HSC-independent and -dependent hematopoiesis: new insights and lineage tracing methods.

Hematopoietic cells are mesodermal in origin and emerge through a highly regulated process known as endothelial-to-hematopoietic transition (EHT), which yields various hematopoietic progenitors 1,2 In...

exphem.org

Submit your research for a chance to give a short talk at the 2026 Mini Symposium taking place 16 April. The presenter of the best short talk, as voted by attendees, will earn a speaking spot at #ISEH2026 🏙️ and will be awarded a Travel Grant! Submit by 28 February to be considered👉

2026 Mini Symposium Abstract Submission

April 16th, 2026 - 3:00 - 6:00pm (US CDT) Online symposium Contact: info@iseh.org The 3rd Mini Symposium organized by the Junior Faculty Committee of the International Society for Experimental…

docs.google.com

Check our new article: Pig and human adult hematopoietic stem and progenitor cells are overall transcriptionally similar We must understand pig hematopoiesis to enable bone marrow xenotransplantation. @qmbci.bsky.social Emma Bailey @foteinikal.bsky.social www.exphem.org/article/S030...

Pig and human adult hematopoietic stem and progenitor cells are overall transcriptionally similar

Allotransplantation provides a lifesaving treatment to hundreds of thousands of patients worldwide every year, including among others heart, kidney, liver and bone marrow transplants1,2. Yet, thousand...

exphem.org

🚨 Paper alert! The final version of our latest manuscript is published. We are excited to share this new resource for the zebrafish community and beyond: doi.org/10.7554/eLif... Congratulations to all authors! 🥳

A single-cell transcriptomic atlas reveals resident dendritic-like cells in the zebrafish brain parenchyma

The zebrafish brain combines a conserved heterogeneity of immune cells with a unique dendritic cell-like population.

doi.org

Join us to pursue cutting-edge research at the interface of megakaryocyte biology and translational medicine. We have NIH-funded postdoc positions available to investigate platelet production and the broader functions of megakaryocytes. I’ll be attending ASH and would be happy to connect.